Basic information for 1110002J07Rik-201-10aa-2
| Peptide Name | 1110002J07Rik-201-10aa-2 |
| Genome Position | chr10:66918401-66918430[-] |
| Species | Mouse |
| Peptide Sequence | MCDPSLTFLG |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.78 |
| Relative Molecular Mass | 1245.45 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000097134;1110002J07Rik |
| Transcript ID/Name | ENSMUST00000181710;1110002J07Rik-201 |
| Transcript Length | 2229 |
| Coding Ability | 0.3836 |
| DNA Sequence Corresponding to Peptide | ATGTGTGATCCATCCTTGACATTCCTGGGG |
m6A
|
Conservation
|
|
|