Basic information for 1700003L19Rik-201-10aa
| Peptide Name | 1700003L19Rik-201-10aa |
| Genome Position | chr16:12848427-12848456[+] |
| Species | Mouse |
| Peptide Sequence | MNCLCIVNDG |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.85 |
| Relative Molecular Mass | 1243.43 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000101565;1700003L19Rik |
| Transcript ID/Name | ENSMUST00000190074;1700003L19Rik-201 |
| Transcript Length | 746 |
| Coding Ability | 0.3794 |
| DNA Sequence Corresponding to Peptide | ATGAACTGCCTCTGCATTGTGAATGATGGA |
|
Conservation
|
|
|