Basic information for 1700100I10Rik-203-10aa
| Peptide Name | 1700100I10Rik-203-10aa |
| Genome Position | chr14:114940878-114940907[-] |
| Species | Mouse |
| Peptide Sequence | MPNINYIFWL |
| Peptide Length | 10 |
| Unique | No (1700100I10Rik-202-10aa) |
| Grand Average of Hydropathicity | 0.67 |
| Relative Molecular Mass | 1472.69 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000115372;1700100I10Rik |
| Transcript ID/Name | ENSMUST00000227763;1700100I10Rik-203 |
| Transcript Length | 1053 |
| Coding Ability | 0.5024 |
| DNA Sequence Corresponding to Peptide | ATGCCAAATATAAACTACATCTTCTGGTTA |
|
Conservation
|
|
|