Basic information for 1700100I10Rik-204-10aa
| Peptide Name | 1700100I10Rik-204-10aa |
| Genome Position | chr14:114940777-114940800,114945464-114945469[-] |
| Species | Mouse |
| Peptide Sequence | MIVFEHLFPS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.09 |
| Relative Molecular Mass | 1381.59 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000115372;1700100I10Rik |
| Transcript ID/Name | ENSMUST00000227825;1700100I10Rik-204 |
| Transcript Length | 342 |
| Coding Ability | 0.3947 |
| DNA Sequence Corresponding to Peptide | ATGATTGTATTTGAGCATCTATTTCCTAGT |
|
Conservation
|
|
|