Basic information for 2900027M19Rik-201-10aa-1
| Peptide Name | 2900027M19Rik-201-10aa-1 |
| Genome Position | chr8:9685880-9685909[-] |
| Species | Mouse |
| Peptide Sequence | MKTCFVLESL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.01 |
| Relative Molecular Mass | 1332.62 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000109162;2900027M19Rik |
| Transcript ID/Name | ENSMUST00000207411;2900027M19Rik-201 |
| Transcript Length | 4448 |
| Coding Ability | 0.4175 |
| DNA Sequence Corresponding to Peptide | ATGAAAACTTGTTTTGTTTTGGAAAGTTTA |
m6A
|
Conservation
|
|
|