Basic information for 4921527H02Rik-201-10aa
| Peptide Name | 4921527H02Rik-201-10aa |
| Genome Position | chr3:124398831-124398860[-] |
| Species | Mouse |
| Peptide Sequence | MNVVVLAFGT |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.83 |
| Relative Molecular Mass | 1212.46 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000106150;4921527H02Rik |
| Transcript ID/Name | ENSMUST00000196005;4921527H02Rik-201 |
| Transcript Length | 1673 |
| Coding Ability | 0.5415 |
| DNA Sequence Corresponding to Peptide | ATGAATGTGGTTGTCCTTGCATTTGGAACA |
|
Conservation
|
|
|