Basic information for 4930555F03Rik-202-10aa-4
| Peptide Name | 4930555F03Rik-202-10aa-4 |
| Genome Position | chr8:49519629-49519658[+] |
| Species | Mouse |
| Peptide Sequence | MYSLLTSDLT |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.55 |
| Relative Molecular Mass | 1305.51 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000031559;4930555F03Rik |
| Transcript ID/Name | ENSMUST00000126285;4930555F03Rik-202 |
| Transcript Length | 3604 |
| Coding Ability | 0.5419 |
| DNA Sequence Corresponding to Peptide | ATGTATTCTCTTCTTACTTCTGATTTGACG |
|
Conservation
|
|
|