Basic information for 4930578M01Rik-203-10aa
| Peptide Name | 4930578M01Rik-203-10aa |
| Genome Position | chr15:98983999-98984028[+] |
| Species | Mouse |
| Peptide Sequence | MSGLSLLLLY |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.76 |
| Relative Molecular Mass | 1271.5 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000097587;4930578M01Rik |
| Transcript ID/Name | ENSMUST00000230737;4930578M01Rik-203 |
| Transcript Length | 1060 |
| Coding Ability | 0.3142 |
| DNA Sequence Corresponding to Peptide | ATGAGTGGGCTCTCACTTCTTCTCTTGTAT |
|
Conservation
|
|
|