Basic information for 8030423J24Rik-201-10aa
| Peptide Name | 8030423J24Rik-201-10aa |
| Genome Position | chr13:70883957-70883986[+] |
| Species | Mouse |
| Peptide Sequence | MCCARGRRFL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.14 |
| Relative Molecular Mass | 1374.65 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000021600;8030423J24Rik |
| Transcript ID/Name | ENSMUST00000225672;8030423J24Rik-201 |
| Transcript Length | 869 |
| Coding Ability | 0.359 |
| DNA Sequence Corresponding to Peptide | ATGTGTTGTGCCAGAGGAAGAAGATTTCTA |
m6A
|
Conservation
|
|
|