Basic information for 9330136K24Rik-201-10aa-1
| Peptide Name | 9330136K24Rik-201-10aa-1 |
| Genome Position | chr17:21528543-21528572[-] |
| Species | Mouse |
| Peptide Sequence | MVVSISSFLQ |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.55 |
| Relative Molecular Mass | 1272.46 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000097781;9330136K24Rik |
| Transcript ID/Name | ENSMUST00000180842;9330136K24Rik-201 |
| Transcript Length | 2478 |
| Coding Ability | 0.2603 |
| DNA Sequence Corresponding to Peptide | ATGGTTGTCTCCATAAGCTCTTTCTTACAA |
|
Conservation
|
|
|