Basic information for 9330162G02Rik-201-10aa-4
| Peptide Name | 9330162G02Rik-201-10aa-4 |
| Genome Position | chr7:59242609-59242638[-] |
| Species | Mouse |
| Peptide Sequence | MHFIFSFPKK |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.14 |
| Relative Molecular Mass | 1443.71 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000109536;9330162G02Rik |
| Transcript ID/Name | ENSMUST00000208498;9330162G02Rik-201 |
| Transcript Length | 30942 |
| Coding Ability | 0.3642 |
| DNA Sequence Corresponding to Peptide | ATGCATTTCATCTTTTCCTTTCCAAAAAAA |
|
Conservation
|
|
|