Basic information for 9330162G02Rik-201-10aa-8
| Peptide Name | 9330162G02Rik-201-10aa-8 |
| Genome Position | chr7:59229119-59229148[-] |
| Species | Mouse |
| Peptide Sequence | MKLSTFGLFF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.21 |
| Relative Molecular Mass | 1352.63 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSMUSG00000109536;9330162G02Rik |
| Transcript ID/Name | ENSMUST00000208498;9330162G02Rik-201 |
| Transcript Length | 30942 |
| Coding Ability | 0.3642 |
| DNA Sequence Corresponding to Peptide | ATGAAACTTTCAACATTTGGTCTGTTTTTT |
m6A
|
Conservation
|
|
|