Basic information for A230107N01Rik-201-10aa-2
| Peptide Name | A230107N01Rik-201-10aa-2 |
| Genome Position | chr13:84221314-84221343[-] |
| Species | Mouse |
| Peptide Sequence | MWKVGFCFLR |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.83 |
| Relative Molecular Mass | 1448.75 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000097292;A230107N01Rik |
| Transcript ID/Name | ENSMUST00000180894;A230107N01Rik-201 |
| Transcript Length | 2348 |
| Coding Ability | 0.5545 |
| DNA Sequence Corresponding to Peptide | ATGTGGAAAGTTGGGTTTTGTTTCCTTAGG |
|
Conservation
|
|
|