Basic information for AABR07005779.7-201-10aa-1
| Peptide Name | AABR07005779.7-201-10aa-1 |
| Genome Position | chr1:198163036-198163065[-] |
| Species | Rat |
| Peptide Sequence | MVCVKAAWAT |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.27 |
| Relative Molecular Mass | 1241.51 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000056571;AABR07005779.7 |
| Transcript ID/Name | ENSRNOT00000085384;AABR07005779.7-201 |
| Transcript Length | 2526 |
| Coding Ability | 0.3785 |
| DNA Sequence Corresponding to Peptide | ATGGTGTGTGTGAAGGCAGCTTGGGCTACA |
|
Conservation
|
|
|