Basic information for AABR07006957.1-201-10aa-1
| Peptide Name | AABR07006957.1-201-10aa-1 |
| Genome Position | chr1:273060520-273060549[+] |
| Species | Rat |
| Peptide Sequence | MFILLPEQVS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.16 |
| Relative Molecular Mass | 1338.56 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000061600;AABR07006957.1 |
| Transcript ID/Name | ENSRNOT00000089277;AABR07006957.1-201 |
| Transcript Length | 1158 |
| Coding Ability | 0.3117 |
| DNA Sequence Corresponding to Peptide | ATGTTTATCCTCCTACCAGAACAAGTGAGT |
|
Conservation
|
|
|