Basic information for AABR07017846.1-201-10aa-2
| Peptide Name | AABR07017846.1-201-10aa-2 |
| Genome Position | chr15:31815488-31815517[+] |
| Species | Rat |
| Peptide Sequence | MLNISLGASQ |
| Peptide Length | 10 |
| Unique | No (AABR07017868.3-201-10aa-1,AABR07017825.5-201-10aa-2) |
| Grand Average of Hydropathicity | 0.68 |
| Relative Molecular Mass | 1195.33 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000054812;AABR07017846.1 |
| Transcript ID/Name | ENSRNOT00000083711;AABR07017846.1-201 |
| Transcript Length | 3599 |
| Coding Ability | 0.4471 |
| DNA Sequence Corresponding to Peptide | ATGTTGAACATTTCTTTGGGTGCCTCTCAG |
|
Conservation
|
|
|