Basic information for AABR07021762.2-201-10aa
| Peptide Name | AABR07021762.2-201-10aa |
| Genome Position | chr13:90220503-90220532[-] |
| Species | Rat |
| Peptide Sequence | MLVCIFIRVT |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.32 |
| Relative Molecular Mass | 1356.73 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000061853;AABR07021762.2 |
| Transcript ID/Name | ENSRNOT00000077896;AABR07021762.2-201 |
| Transcript Length | 2059 |
| Coding Ability | 0.3414 |
| DNA Sequence Corresponding to Peptide | ATGCTTGTCTGCATCTTCATTAGAGTTACA |
|
Conservation
|
|
|