Basic information for AABR07024468.1-201-10aa-2
| Peptide Name | AABR07024468.1-201-10aa-2 |
| Genome Position | chr16:571641-571670[-] |
| Species | Rat |
| Peptide Sequence | MSLSSGVRFF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.82 |
| Relative Molecular Mass | 1292.45 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000060607;AABR07024468.1 |
| Transcript ID/Name | ENSRNOT00000089982;AABR07024468.1-201 |
| Transcript Length | 1522 |
| Coding Ability | 0.5145 |
| DNA Sequence Corresponding to Peptide | ATGTCCCTATCCTCTGGTGTACGATTTTTC |
|
Conservation
|
|
|