Basic information for AABR07024473.2-203-10aa
| Peptide Name | AABR07024473.2-203-10aa |
| Genome Position | chr16:603433-603462[-] |
| Species | Rat |
| Peptide Sequence | MKKCCLIFKG |
| Peptide Length | 10 |
| Unique | No (AABR07010985.1-201-10aa-1) |
| Grand Average of Hydropathicity | 0.59 |
| Relative Molecular Mass | 1332.7 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000061982;AABR07024473.2 |
| Transcript ID/Name | ENSRNOT00000092308;AABR07024473.2-203 |
| Transcript Length | 1003 |
| Coding Ability | 0.323 |
| DNA Sequence Corresponding to Peptide | ATGAAGAAATGTTGCCTGATCTTTAAGGGA |
|
Conservation
|
|
|