Basic information for AABR07026114.1-201-10aa
| Peptide Name | AABR07026114.1-201-10aa |
| Genome Position | chr16:64877565-64877594[+] |
| Species | Rat |
| Peptide Sequence | MSYLFIRIFY |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.24 |
| Relative Molecular Mass | 1514.77 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000061891;AABR07026114.1 |
| Transcript ID/Name | ENSRNOT00000091360;AABR07026114.1-201 |
| Transcript Length | 980 |
| Coding Ability | 0.4776 |
| DNA Sequence Corresponding to Peptide | ATGTCATATTTATTCATCCGTATTTTTTAT |
|
Conservation
|
|
|