Basic information for AABR07027870.2-201-10aa
| Peptide Name | AABR07027870.2-201-10aa |
| Genome Position | chr17:47711839-47711868[-] |
| Species | Rat |
| Peptide Sequence | MRLFQKKLVT |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0 |
| Relative Molecular Mass | 1425.78 |
| Experimental Evidences | 1:lncORF |
| lncRNA ID/Name | ENSRNOG00000061816;AABR07027870.2 |
| Transcript ID/Name | ENSRNOT00000085839;AABR07027870.2-201 |
| Transcript Length | 2558 |
| Coding Ability | 0.4734 |
| DNA Sequence Corresponding to Peptide | ATGAGACTCTTCCAGAAGAAGTTGGTCACC |
lncORF
|
Conservation
|
|
|