Basic information for AABR07028469.1-201-10aa
| Peptide Name | AABR07028469.1-201-10aa |
| Genome Position | chr17:71459682-71459711[-] |
| Species | Rat |
| Peptide Sequence | MVGKHLVRTG |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.1 |
| Relative Molecular Mass | 1259.53 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000051695;AABR07028469.1 |
| Transcript ID/Name | ENSRNOT00000090314;AABR07028469.1-201 |
| Transcript Length | 545 |
| Coding Ability | 0.356 |
| DNA Sequence Corresponding to Peptide | ATGGTTGGGAAACATCTGGTCCGGACCGGA |
|
Conservation
|
|
|