Basic information for AABR07031588.1-201-10aa-4
| Peptide Name | AABR07031588.1-201-10aa-4 |
| Genome Position | chr18:21113786-21113815[+] |
| Species | Rat |
| Peptide Sequence | MTKLPLLPIW |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.91 |
| Relative Molecular Mass | 1373.72 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000055148;AABR07031588.1 |
| Transcript ID/Name | ENSRNOT00000091842;AABR07031588.1-201 |
| Transcript Length | 2956 |
| Coding Ability | 0.3369 |
| DNA Sequence Corresponding to Peptide | ATGACTAAGCTGCCTCTTCTACCCATATGG |
|
Conservation
|
|
|