Basic information for AABR07035012.1-201-10aa-2
| Peptide Name | AABR07035012.1-201-10aa-2 |
| Genome Position | chr12:3280784-3280813[+] |
| Species | Rat |
| Peptide Sequence | MLHISYCLLL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.88 |
| Relative Molecular Mass | 1367.66 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000061869;AABR07035012.1 |
| Transcript ID/Name | ENSRNOT00000088456;AABR07035012.1-201 |
| Transcript Length | 4881 |
| Coding Ability | 0.4585 |
| DNA Sequence Corresponding to Peptide | ATGCTGCATATTTCATATTGTTTGCTATTG |
|
Conservation
|
|
|