Basic information for AABR07035273.1-201-10aa
| Peptide Name | AABR07035273.1-201-10aa |
| Genome Position | chr12:9335141-9335170[+] |
| Species | Rat |
| Peptide Sequence | MLYSLSYSLF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.11 |
| Relative Molecular Mass | 1385.56 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000055687;AABR07035273.1 |
| Transcript ID/Name | ENSRNOT00000083249;AABR07035273.1-201 |
| Transcript Length | 5385 |
| Coding Ability | 0.3851 |
| DNA Sequence Corresponding to Peptide | ATGTTGTATTCATTAAGTTATTCTCTGTTC |
|
Conservation
|
|
|