Basic information for AABR07040953.1-201-10aa
| Peptide Name | AABR07040953.1-201-10aa |
| Genome Position | chrX:115599766-115599795[-] |
| Species | Rat |
| Peptide Sequence | MRSDVLFWCV |
| Peptide Length | 10 |
| Unique | No (Platr9-201-10aa,Gm42729-201-10aa) |
| Grand Average of Hydropathicity | 0.97 |
| Relative Molecular Mass | 1417.64 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000051073;AABR07040953.1 |
| Transcript ID/Name | ENSRNOT00000076494;AABR07040953.1-201 |
| Transcript Length | 1603 |
| Coding Ability | 0.3425 |
| DNA Sequence Corresponding to Peptide | ATGAGATCTGATGTCCTCTTCTGGTGTGTC |
|
Conservation
|
|
|