Basic information for AABR07044001.4-201-10aa-2
| Peptide Name | AABR07044001.4-201-10aa-2 |
| Genome Position | chr19:52052072-52052101[-] |
| Species | Rat |
| Peptide Sequence | MLSPWIRYDL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.14 |
| Relative Molecular Mass | 1455.65 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSRNOG00000058847;AABR07044001.4 |
| Transcript ID/Name | ENSRNOT00000089288;AABR07044001.4-201 |
| Transcript Length | 2717 |
| Coding Ability | 0.3441 |
| DNA Sequence Corresponding to Peptide | ATGCTCTCTCCCTGGATACGTTACGACCTA |
|
Conservation
|
|
|