Basic information for AABR07047174.3-201-10aa-2
| Peptide Name | AABR07047174.3-201-10aa-2 |
| Genome Position | chr5:22253456-22253485[+] |
| Species | Rat |
| Peptide Sequence | MPVRSKVVSL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.67 |
| Relative Molecular Mass | 1277.53 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000058791;AABR07047174.3 |
| Transcript ID/Name | ENSRNOT00000090341;AABR07047174.3-201 |
| Transcript Length | 615 |
| Coding Ability | 0.7805 |
| DNA Sequence Corresponding to Peptide | ATGCCTGTGAGAAGCAAGGTTGTTTCTCTT |
|
Conservation
|
|
|