Basic information for AABR07063508.1-201-10aa
| Peptide Name | AABR07063508.1-201-10aa |
| Genome Position | chr6:32415143-32415172[-] |
| Species | Rat |
| Peptide Sequence | MFLLGDGFVL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.88 |
| Relative Molecular Mass | 1273.49 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000056107;AABR07063508.1 |
| Transcript ID/Name | ENSRNOT00000082063;AABR07063508.1-201 |
| Transcript Length | 349 |
| Coding Ability | 0.4126 |
| DNA Sequence Corresponding to Peptide | ATGTTCCTCCTGGGTGATGGCTTCGTGTTG |
|
Conservation
|
|
|