Basic information for AABR07063511.2-201-10aa
| Peptide Name | AABR07063511.2-201-10aa |
| Genome Position | chr6:32581935-32581964[-] |
| Species | Rat |
| Peptide Sequence | MLCSNVISSR |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.65 |
| Relative Molecular Mass | 1271.45 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000055114;AABR07063511.2 |
| Transcript ID/Name | ENSRNOT00000089260;AABR07063511.2-201 |
| Transcript Length | 529 |
| Coding Ability | 0.794 |
| DNA Sequence Corresponding to Peptide | ATGCTGTGTTCAAATGTCATATCTTCCAGG |
|
Conservation
|
|
|