Basic information for AABR07063613.1-201-10aa
| Peptide Name | AABR07063613.1-201-10aa |
| Genome Position | chr6:37188727-37188756[+] |
| Species | Rat |
| Peptide Sequence | MESPLRLTVL |
| Peptide Length | 10 |
| Unique | No (AABR07063613.1-202-10aa-1) |
| Grand Average of Hydropathicity | 0.64 |
| Relative Molecular Mass | 1320.58 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000053708;AABR07063613.1 |
| Transcript ID/Name | ENSRNOT00000089368;AABR07063613.1-201 |
| Transcript Length | 430 |
| Coding Ability | 0.493 |
| DNA Sequence Corresponding to Peptide | ATGGAGAGTCCTCTCAGGCTCACCGTATTA |
|
Conservation
|
|
|