Basic information for AABR07068094.2-201-10aa-3
| Peptide Name | AABR07068094.2-201-10aa-3 |
| Genome Position | chr9:83417054-83417083[-] |
| Species | Rat |
| Peptide Sequence | MVGCFLVLLD |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.31 |
| Relative Molecular Mass | 1271.54 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000055588;AABR07068094.2 |
| Transcript ID/Name | ENSRNOT00000085866;AABR07068094.2-201 |
| Transcript Length | 1418 |
| Coding Ability | 0.5367 |
| DNA Sequence Corresponding to Peptide | ATGGTTGGTTGTTTTCTTGTTCTTCTTGAT |
|
Conservation
|
|
|