Basic information for AABR07068590.2-201-10aa-2
| Peptide Name | AABR07068590.2-201-10aa-2 |
| Genome Position | chr9:110402893-110402922[-] |
| Species | Rat |
| Peptide Sequence | MPLKPGLHFI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.61 |
| Relative Molecular Mass | 1314.59 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000057630;AABR07068590.2 |
| Transcript ID/Name | ENSRNOT00000077292;AABR07068590.2-201 |
| Transcript Length | 896 |
| Coding Ability | 0.2857 |
| DNA Sequence Corresponding to Peptide | ATGCCTTTAAAACCGGGGCTACATTTTATT |
|
Conservation
|
|
|