Basic information for AABR07069816.1-201-10aa-1
| Peptide Name | AABR07069816.1-201-10aa-1 |
| Genome Position | chr8:40793533-40793562[-] |
| Species | Rat |
| Peptide Sequence | MLESCGINLS |
| Peptide Length | 10 |
| Unique | No (AABR07069816.1-201-10aa-3) |
| Grand Average of Hydropathicity | 0.75 |
| Relative Molecular Mass | 1228.38 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000052868;AABR07069816.1 |
| Transcript ID/Name | ENSRNOT00000086487;AABR07069816.1-201 |
| Transcript Length | 3396 |
| Coding Ability | 0.5333 |
| DNA Sequence Corresponding to Peptide | ATGCTGGAATCTTGTGGCATTAACCTGAGC |
|
Conservation
|
|
|