Basic information for AABR07072374.2-201-10aa-3
| Peptide Name | AABR07072374.2-201-10aa-3 |
| Genome Position | chr14:11453529-11453558[-] |
| Species | Rat |
| Peptide Sequence | MLYLHIVSLL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.05 |
| Relative Molecular Mass | 1363.65 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000057504;AABR07072374.2 |
| Transcript ID/Name | ENSRNOT00000090980;AABR07072374.2-201 |
| Transcript Length | 1314 |
| Coding Ability | 0.5175 |
| DNA Sequence Corresponding to Peptide | ATGTTATATTTACATATCGTAAGTTTACTG |
|
Conservation
|
|
|