Basic information for AC002066.1-203-10aa
| Peptide Name | AC002066.1-203-10aa |
| Genome Position | chr7:116417254-116417283[-] |
| Species | Human |
| Peptide Sequence | MALIKDICLL |
| Peptide Length | 10 |
| Unique | No (AC002066.1-202-10aa) |
| Grand Average of Hydropathicity | 1.92 |
| Relative Molecular Mass | 1294.6 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSG00000237813;AC002066.1 |
| Transcript ID/Name | ENST00000656866;AC002066.1-203 |
| Transcript Length | 538 |
| Coding Ability | 0.7286 |
| DNA Sequence Corresponding to Peptide | ATGGCACTCATTAAGGACATCTGTCTTCTG |
m6A
|
Conservation
|
|
|