Basic information for AC002451.1-211-10aa
| Peptide Name | AC002451.1-211-10aa |
| Genome Position | chr7:95607741-95607770[+] |
| Species | Human |
| Peptide Sequence | MDHNIFSCVI |
| Peptide Length | 10 |
| Unique | No (AC002451.1-205-10aa) |
| Grand Average of Hydropathicity | 0.94 |
| Relative Molecular Mass | 1340.52 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000231170;AC002451.1 |
| Transcript ID/Name | ENST00000667350;AC002451.1-211 |
| Transcript Length | 1421 |
| Coding Ability | 0.6186 |
| DNA Sequence Corresponding to Peptide | ATGGATCATAACATCTTCTCCTGTGTGATC |
|
Conservation
|
|
|