Basic information for AC004448.2-215-10aa
| Peptide Name | AC004448.2-215-10aa |
| Genome Position | chr17:19492913-19492942[-] |
| Species | Human |
| Peptide Sequence | MWATISIAAF |
| Peptide Length | 10 |
| Unique | No (AC004448.2-212-10aa) |
| Grand Average of Hydropathicity | 1.67 |
| Relative Molecular Mass | 1272.48 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000235979;AC004448.2 |
| Transcript ID/Name | ENST00000582654;AC004448.2-215 |
| Transcript Length | 485 |
| Coding Ability | 0.499 |
| DNA Sequence Corresponding to Peptide | ATGTGGGCCACCATCTCCATAGCTGCTTTC |
|
Conservation
|
|
|