Basic information for AC005336.3-201-10aa
| Peptide Name | AC005336.3-201-10aa |
| Genome Position | chr19:15907026-15907055[+] |
| Species | Human |
| Peptide Sequence | MICPVLRLGY |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.29 |
| Relative Molecular Mass | 1326.62 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000279717;AC005336.3 |
| Transcript ID/Name | ENST00000623833;AC005336.3-201 |
| Transcript Length | 2679 |
| Coding Ability | 0.4584 |
| DNA Sequence Corresponding to Peptide | ATGATCTGTCCAGTATTGAGATTGGGTTAT |
|
Conservation
|
|
|