Basic information for AC005394.2-201-10aa-1
| Peptide Name | AC005394.2-201-10aa-1 |
| Genome Position | chr19:28437504-28437533[-] |
| Species | Human |
| Peptide Sequence | MLQGVYVSPS |
| Peptide Length | 10 |
| Unique | No (AC005381.1-202-10aa-2,AC005381.1-201-10aa-1) |
| Grand Average of Hydropathicity | 0.57 |
| Relative Molecular Mass | 1242.4 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000283403;AC005394.2 |
| Transcript ID/Name | ENST00000592347;AC005394.2-201 |
| Transcript Length | 3113 |
| Coding Ability | 0.4035 |
| DNA Sequence Corresponding to Peptide | ATGCTCCAGGGAGTTTATGTCTCCCCATCT |
|
Conservation
|
|
|