Basic information for AC005394.2-201-10aa-2
| Peptide Name | AC005394.2-201-10aa-2 |
| Genome Position | chr19:28435857-28435886[-] |
| Species | Human |
| Peptide Sequence | MVIGDVKRQV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.32 |
| Relative Molecular Mass | 1306.54 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000283403;AC005394.2 |
| Transcript ID/Name | ENST00000592347;AC005394.2-201 |
| Transcript Length | 3113 |
| Coding Ability | 0.4035 |
| DNA Sequence Corresponding to Peptide | ATGGTTATTGGTGATGTTAAAAGACAAGTT |
m6A
|
Conservation
|
|
|