Basic information for AC005495.2-201-10aa
| Peptide Name | AC005495.2-201-10aa |
| Genome Position | chr17:69243921-69243950[+] |
| Species | Human |
| Peptide Sequence | MLEILENLIF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.46 |
| Relative Molecular Mass | 1396.63 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000285931;AC005495.2 |
| Transcript ID/Name | ENST00000650511;AC005495.2-201 |
| Transcript Length | 511 |
| Coding Ability | 0.1703 |
| DNA Sequence Corresponding to Peptide | ATGCTTGAAATTCTTGAGAACTTGATTTTT |
|
Conservation
|
|
|