Basic information for AC005498.3-201-10aa
| Peptide Name | AC005498.3-201-10aa |
| Genome Position | chr19:56546963-56546992[-] |
| Species | Human |
| Peptide Sequence | MTTVLLHEAW |
| Peptide Length | 10 |
| Unique | No (AC005498.3-202-10aa) |
| Grand Average of Hydropathicity | 0.65 |
| Relative Molecular Mass | 1362.62 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000269696;AC005498.3 |
| Transcript ID/Name | ENST00000596587;AC005498.3-201 |
| Transcript Length | 2045 |
| Coding Ability | 0.4098 |
| DNA Sequence Corresponding to Peptide | ATGACTACTGTCCTTCTGCATGAAGCCTGG |
m6A
|
Conservation
|
|
|