Basic information for AC005740.5-201-10aa
| Peptide Name | AC005740.5-201-10aa |
| Genome Position | chr5:141894219-141894248[+] |
| Species | Human |
| Peptide Sequence | MKKILTSTLE |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.05 |
| Relative Molecular Mass | 1325.64 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000287726;AC005740.5 |
| Transcript ID/Name | ENST00000659661;AC005740.5-201 |
| Transcript Length | 2119 |
| Coding Ability | 0.5097 |
| DNA Sequence Corresponding to Peptide | ATGAAAAAGATTTTGACAAGTACCCTGGAA |
|
Conservation
|
|
|