Basic information for AC005840.2-201-10aa-1
| Peptide Name | AC005840.2-201-10aa-1 |
| Genome Position | chr12:6394761-6394790[+] |
| Species | Human |
| Peptide Sequence | MHREVFLSRV |
| Peptide Length | 10 |
| Unique | No (AC005840.2-202-10aa) |
| Grand Average of Hydropathicity | 0.04 |
| Relative Molecular Mass | 1435.65 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000256433;AC005840.2 |
| Transcript ID/Name | ENST00000541888;AC005840.2-201 |
| Transcript Length | 1803 |
| Coding Ability | 0.5136 |
| DNA Sequence Corresponding to Peptide | ATGCACAGGGAAGTCTTCCTTTCCAGGGTA |
m6A
|
Conservation
|
|
|