Basic information for AC006115.2-216-10aa-1
| Peptide Name | AC006115.2-216-10aa-1 |
| Genome Position | chr19:56790156-56790185[+] |
| Species | Human |
| Peptide Sequence | MLQWLPLPSK |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.1 |
| Relative Molecular Mass | 1374.63 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000286125;AC006115.2 |
| Transcript ID/Name | ENST00000651337;AC006115.2-216 |
| Transcript Length | 2200 |
| Coding Ability | 0.4473 |
| DNA Sequence Corresponding to Peptide | ATGCTTCAATGGCTCCCACTGCCTTCCAAA |
|
Conservation
|
|
|