Basic information for AC006116.8-203-10aa-4
| Peptide Name | AC006116.8-203-10aa-4 |
| Genome Position | chr19:56364974-56365003[+] |
| Species | Human |
| Peptide Sequence | MGIHIIVLYT |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.78 |
| Relative Molecular Mass | 1321.62 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSG00000267549;AC006116.8 |
| Transcript ID/Name | ENST00000651636;AC006116.8-203 |
| Transcript Length | 3180 |
| Coding Ability | 0.3126 |
| DNA Sequence Corresponding to Peptide | ATGGGCATACACATCATCGTGCTGTACACT |
m6A
|
Conservation
|
|
|