Basic information for AC007262.2-202-10aa
| Peptide Name | AC007262.2-202-10aa |
| Genome Position | chr14:81013623-81013652[-] |
| Species | Human |
| Peptide Sequence | MGENFRNLVI |
| Peptide Length | 10 |
| Unique | No (AC007262.2-201-10aa) |
| Grand Average of Hydropathicity | 0.18 |
| Relative Molecular Mass | 1354.53 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000284959;AC007262.2 |
| Transcript ID/Name | ENST00000654681;AC007262.2-202 |
| Transcript Length | 3025 |
| Coding Ability | 0.2707 |
| DNA Sequence Corresponding to Peptide | ATGGGAGAAAATTTTCGCAACCTAGTCATC |
|
Conservation
|
|
|