Basic information for AC007262.2-204-10aa-2
| Peptide Name | AC007262.2-204-10aa-2 |
| Genome Position | chr14:81051513-81051542[-] |
| Species | Human |
| Peptide Sequence | MAVIKKVNAS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.63 |
| Relative Molecular Mass | 1222.45 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000284959;AC007262.2 |
| Transcript ID/Name | ENST00000646928;AC007262.2-204 |
| Transcript Length | 5577 |
| Coding Ability | 0.4271 |
| DNA Sequence Corresponding to Peptide | ATGGCTGTCATCAAAAAGGTGAATGCTAGC |
|
Conservation
|
|
|