Basic information for AC007513.1-201-10aa
| Peptide Name | AC007513.1-201-10aa |
| Genome Position | chr12:96483588-96483617[-] |
| Species | Human |
| Peptide Sequence | MLQEVISLSY |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.83 |
| Relative Molecular Mass | 1344.52 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000258272;AC007513.1 |
| Transcript ID/Name | ENST00000548740;AC007513.1-201 |
| Transcript Length | 379 |
| Coding Ability | 0.4828 |
| DNA Sequence Corresponding to Peptide | ATGCTTCAAGAAGTCATCTCATTAAGTTAT |
|
Conservation
|
|
|